An introduction to BLAST - Basic Local Alignment Search Tool!

Hey friends:

BLAST is an acronym for Basic Local Alignment Search Tool, and it consists of a set of algorithms for comparing biological sequences such as nucleotides or protein sequences. A nucleotide sequence is nothing but a DNA (or part of) sequence expressed as a long string of 4 characters: A,T,C and G. They stand for Adenine, Guanine, Cytosine and Thymine. So, every nucleotide sequence consists of only these four characters arranged in different orders.

BLAST allows you to compare your sequence against a database of sequences and informs you if your sequence matches any of the sequences in the database, along with a lot of information like:

• Homology of match (% of characters matched)
• Alignment length (over what length did the nucleotides match)
• Evalue (Expectation value. The number of different alignents with scores equivalent to or better than S that are expected to occur in a database search by chance. The lower the E value, the more significant the score)

For a complete BLAST glossary you may visit http://www.ncbi.nlm.nih.gov/Education/BLASTinfo/glossary2.html

So, now that you know BLAST can be used to align two sequences and to study the similarity between two or more sequences, let us look into the principles of sequence alignment briefly.

Sequence alignment refers to arranging two sequences in an order such that their similar portions are highlighted.

For ex:

AGCTATGGGCAAATTTGGAACAAACCAAAAAGT
........ ........ ...............
AGCTATGGACAAATTTGCAACAAACCAAAAAGT

The portions in the sequence which do not match are shown by gaps in the alignment.

Global Alignment: It refers to the alignment in which all the characters in both sequences participate in the alignment.

Local Alignment: It refers to finding closely matching regions between sequences. In local alignment the beginning part (say 0.100 nucleotides) of a sequence may align with the ending part of another sequence (say 400-500).

Links:

• A very interesting article on Sequence Alignment can be read here. http://www.answers.com/sequence%20alignment
• NCBI's blast tool can be found at http://www.ncbi.nlm.nih.gov/blast/
• An article on methodology behind blast, http://www.ncbi.nlm.nih.gov/BLAST/tutorial/Altschul-1.html

----------------------------------------------------------------------------------------
Puneet Wadhwa

www.puneetwadhwa.com